Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604419
Length 654 bp
Fasta Format > rwhv3n1f09
ataggtatactcaatatctttatatattaacaaaacatgcccagcaatcg cttggatgcgatgcggtacttaggtacaaaggataaaacatcagatatta aattggcatgcttaaaaggtgtaaaggcagctgccgtcgtcactcctcgc cgttgggtcgaagttcttggcagtctggtcggtgcatcctgccggtacag gcaaagtaccttgctgtgcccctttacctcctcctatgcagcaagagatg gtgggtgtgtatggagaatgttctaaccgtagaaggtaccagtcttcatc gcatcctggttagcatcacccagagctgcctggctcatgtaggtgtcagc aagctgcacacgcttgacattgtcctgctcctggacgagcatgtgcccgt actctagcagcttctccactgtcatctttggctgctcaaaggtcactggt ccgtcccgcgagttcaccagcttcttgccaatgttctcgataccggtaga ggtcacccacttgcgcacctcgtcgtcgtacacccgagcacgcanagcac cgaaaaagtcnatggattgtcctgggaaggtgtcgacnatcttgacnacn gactcntcnctgacattgtcngnctgnaanatacccttgcnnacaccgat acng
Download
page-top