Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604413
Length 498 bp
Fasta Format > rwhv3n1f02
cttcgattgcttccgaagtagagtactttaaatttaagatcacnaacact ggagccgacgaatgccctaaagccctcgagctacgtacactcgtgacatc acaggatcaacaataccaagttccaaaaaaaatgaaatccacaatattca atacatacaagcttacncaaagacatgctatcttaacacagacagcatca gttgctcgtgcacagcgactcgctcgtccaagcctggatcctgcagcaga ggctgtttgcttaaactaccagcacgtacaccgcgtagatgatccccggt atgtaccccagtatggtcagcaagagacagatccagaactccacgccgag tttgtagcgcaggaagacgccgacgggaggcaggatgatggcgaggatca cctccaggactgttgccgagcccatggcttgctcacttcactcgaggccc tctcctttctttctctctgctttttttttttttnnaaanaaaaagggg
Download
page-top