Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604411
Length 732 bp
Fasta Format > rwhv3n1e22
tgtataatattatgcgtccgttcatatacatagccaccgatagcattctc atacgagcatgctttctcgagccatgttggtacatgaacatggacataca catattcttaggaacaaataagaaagataaatggagaaggaaaacccaaa gcaatgtcagagttgacaaaactgcaatggcactttatatatggcctgtc gtgagtgagctgtttaggccttgccggactcctcgcagcccggtggcttg aaggcgatgaagctgacgcactgcacctggcgcatgttgtcgaatccgat gatgcggacatacgcgtcagggtactccttcttgacctcctccacctcgt tgatcacttgtgtggcgtcggtgcacccgaacataggcagcttccacatt gtccagtaccggccatcatagtacccaggggatgcgttgtgctcacggaa gatgaacccaaccttgctgaactcgaggcaaggcacccacttggagcgga tcaggtagtcgacctgcttgaggagggcctccgtgctgagcggtggcaag taggacagggtctcgaacttcttgatgccctcaatgggccacacctgcat gcacctgatccttccaccgttgctgacgctgccgaggctagcgccgttgg agcggcggctgacggggaggccggcggtggacttgagcccctggaaagga gcgacggaggtggccgacgaggccatcacggt
Download
page-top