Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604398
Length 766 bp
Fasta Format > rwhv3n1d24
atatattatgtgcatgtgcatatacatagccaccgattgcattcacatac gagcacgctttctcgagccatgttgttacatgaacatggacatacacata ttcttaggaacaagtaagaaagacaaatggagaaggaaaacccaaagcaa tgtcagagttgacaaaactgcaatggcactttatatgtggcccgtggtga gtgagctgtttaggccttgccggactcctcgcagcccggtggcttgaagg caatgaagctgacgcactgcacctggcgcatgttgtcgaatccgatgatg cggacgtacgcgtcagggtactccttcttgacctcctccacctcgttgat cacctgtgtggcgtcggtgcacccgaacataggcagcttccacattgtcc agtagcggccgtcgtagtacccgggagacgcattgtgctcacggaagatg aacccgaccttgctgaactcaaggcaaggcacccacttggagcggatcag gtagtccacctgcttgaggagggcctccgtgctgagcggtggcaggtaag acagggtctcgaacttcttgatgccctcgatgggccacacctgcatgcac ctgatccttccaccgttgctgacgctgccgaggctancgccgttggancg gcggctgacggggaggccggcggtggacttgancccctggaaangancna cngangtggccnacnangccntcncnnngnnctcnngccnaattcctncn nnccnnnnnatccnnt
Download
page-top