Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604393
Length 708 bp
Fasta Format > rwhv3n1d18
gccggttctagaatttgcatatgcatgctcgagaacctatgttcgtacat acatacacagaccatatagaatgaaaaatatgctctggtcgtccagcaga gtcgtggacaaaagtgacgttcacaaaagaccttcatacataggccattg tttcaactcgtagtttaggccttgccagactcctcgcaacccggtggcct gaaggcgatgaagctgacgcactgcacctggcgcaggttgtcgaagccga tgacgcggacataggcgtcagggtactccttcttgacctcctccacctcg ttgagcacctgtgtggcgtcggtgcacccgaacataggcagcttccacat tgtccagtatcgaccgtcatagtatccgggggagctattgtgctcacgga agacgaaaccaaccttgctgaactcgaggcagggcacccacttggagcgg atcaagtagtcgacctgcttcaggagggcctccgtggagaggggtggcag gtaagacagggtctcgaacttcttgatgccctcaatcggccacacctgca tgcacctgatccttccgccgttgctgacgctgctgaggccggcgctgctg gagcggcggctgatgggcaggccggcggtcnacttgagaccctggaaggg tgcgacggaggtggccgaggaaccatcacagtgggggccatggtgttggc ctcgtgcc
Download
page-top