Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604388
Length 602 bp
Fasta Format > rwhv3n1d07
agagtattcgatatggttgcagcaaaaggattgataagcgaacaagggag cactagtgggcgtcctcctcctcgcagtgcttggtgtacttggccgagtc cagcaggccctccagctccgccgggctgctcggcttcaccttgatcatcc acccctcctcgtacgggctcgagttgatcaggcccggggtctcggacagc ttcgaattgacctcgacgacctcgccggagatgggcgagttgacgtcgct ggtggccttcacactctccacgttgccgaaggccccaccctggctcacct tcgtgccggtctccggcagctccacgaacaccacctccccgagatggccc tgggcgtggtcactgatgccaatcgtggccacggagccgtcgttcttgac ccactcgtgggaggaagtgtacttcaagccatcaataacggtggagaagt atctggagatcgagtaggccggggcagcggccctggcgccgctgcttgaa atcttgagggnattggcanctgancttgcccacagcctcanagccattgt ancctaatttanctgttgcaaccggcacnangnctcntgccnaattcctg ca
Download
page-top