Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604384
Length 773 bp
Fasta Format > rwhv3n1c24
aatcttttctttcaccaaatacaacttttaccaggacattgtgaaggcag agtaatcgagtacctacccggtgactcaggttcacgacacagcaatgccc ttccatctgtaaggctacaagagattgactgctgctcccattttagagaa accaagcagccgcaggttagactaaaatttggacttctcatcatacatat agttttcaaacgaaactgaacacaaattgagctggcaaaatagcttgctt ctgataaatctgtgacgctccaccgatgcagcttgactttaattagttcc agctgctgagcgccgctgccaggcccgtttgagcatctactgcacgacgc agatcttcgaggaagttcatctgatgaggaagcttcatgtgaccttgacc ccatgacgatccgccagatccagcgtacatcactggtttatcaggggaat catttgggtcattatacatgttcattgcagcagcccaacgttcactgaga agctgtgaagcctcactggcagaacatccttccaatggtactaatcttgc atgactgtaatcattttgagcattgctgacaaaagcatcatgatggataa ttggaggaaggttctttagtgaaggaacatggctcttctctccatcattg ttgtatgaatagttggctttctcagccctatctccagccttgcggcgatt gtttgcacgattcctgtgcacgggaggcgtgtatctcttgatgctgtccg ggttgctatccgccatggcanca
Download
page-top