Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604380
Length 663 bp
Fasta Format > rwhv3n1c14
aacggatttcaagctagtcattcttcacatgtatacatacgagcaagaat atcctacgagtagcaacttctaagtgttctccacatcagattcacacacg gacaagtgcgagaatacatcaaattcagatccacttaaaatgcatcaaga aagcaacacacacattgctagcatgggcagcctagatccaccgggaagtt gcagcgctgcaaccaaaccaaatgtgtacagggcccctgtcacagccagc aagcatactagatgcagcaacagtgcgatgaggacgggcatgccaacgcg ccggtggcggggtccgaaagcggaggccggcttgggcaggagtagtgaca cggctgggccgagagtcattgccgaacctgctgctggggcggtacacacg ggcggatggatctagcacgcgggcggctcaagcggccatgcgcacgaatc ccttggggcggcgatgcggctgacgacgggtggcgcgaagctccgcagcc gtccatggcgtcgggtcctgagagggagagggcaagggatgaggcatagg ggatagatagagaacgaggaatataggcaggaggaaggagacggaggtag ggcggcggagcttgagatggtgctcgtcggcggcttggggaacggcggga ggtanaantnnnt
Download
page-top