Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604379
Length 858 bp
Fasta Format > rwhv3n1c11
tgcagccagagacaggcatttccatacattcgctcacactggcagaaaac gctaaccattttcacgtcacttgtccataacaaaagtaataggacaggaa caggaaatctctaagaacaaactgacgcaacacaagctcgttcagaccag ctagcatcaccatcagcagctcttcatcctcttaacagcccccctctcat ccttctcctgcgcagcatcgtcttcccagcaaaggaaagcatccatcttg gagccgctctctaaattgccatgaacgttgcagttcaggacagatcttgg tgacccggtggagtcttcgccgacagcagtgaagctctggtagatgagag cgcccccgtcaggcagctcctggacgaccatgttggtactatcatagacc ccaacattcagcctctccccccaggtgccagcaaggttgcgaccgccaaa gatggtcacagcaacagagaattcagacgggccaaaggatctcagcaccc tcttgaccaggtcaccataggccatggaggcagggtccaaccccatgacc tcatagctagcatagctgaagccgtcctcaggagtgacatgaatggtgga gaaagcagagccatggatggcgttcatggagtagccacatggctcgaaat caaagtcacagatctccatctccgggattatttcagagatgccagagagc ttggtcatctccttggcacaagatgtgtagccatcagcagaggtcttgaa gaagacagaagctttcttcttgtccagaaccagtcatgcacatctcaagg ttgaccatgggctgctcangctgctggggtggcatantanacatgccacn ttctggcc
Download
page-top