Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604378
Length 548 bp
Fasta Format > rwhv3n1c10
aagtacgcttcacaactggaagctcgccggcctcagtttcttcatagacg agcgggtgaaacatgtcaaggcagtacccagactcgtaaactcacacttc tagtagttccacaattacaaaagcaaaacgaatcaatcactggagatata tatgtactgcttgagaccttggtactctagcgtggtgccttctgaacagc tcaatggccctctatacctggtttcttatacggacgacagccagcgataa gctcgatcctctcaaaacaacccatcactaaggcggcgaaggcgaaggag aggccggcggtttgagatctggatagttcgcatatggcgaaagaggcctg ggcttcgcaggaggcgatgactcttcgacagcttctgccaccggtgccga gttaacttccgccggcgattcggttgctgcgacaacggtggccttcacct cggttttaccctctgaagctggtggggaagggctggccggtggtttgaga tctgggtaatttgcaaatggtgacaggggtctcgatgatgttgtggta
Download
page-top