Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604377
Length 599 bp
Fasta Format > rwhv3n1c08
tattaacttatatatgatgtcttttgatcacaggacgatcaaattatgca tcacatggtagtacaattcctcgtcagaaaatggtaaaagaaaaagggtt ctattgcttatggcgaattcacatcgggccatcccggcatccagtactgg aaaacaacgagtacgcactccatggcattggattcacatcggtcggtcgg acgatatcttgatatatgtacgcgtttgcattcgcatgtatatataggag ttaaccgctggggaagatttactgctcccatgtctcgaacttgccggaga cgaagtcgtaatggccgccgacgagcttgagggttccgttggacacaccc tccttgacgaacgggtaggtcaggaggttctgcagggacacgttcactgc ctccttttcgaggacggtgcactggtcatcgaaaggcatggaggcgcact cagtctgcaccttcttcttggccgggaagccgatcctgacccagtcctcg acgaagtggaaggagtcgtctgcgccatccttgagtgagagcagagcctt gattccaccgcagcggctgtggccaatcaccacgatgaccggcacgagg
Download
page-top