Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604359
Length 674 bp
Fasta Format > rwhv3n1a20
actggatacaagaaacaggtgcatttatagcaggagtagtcttatagcag cgttcttaggactggcaggaggcttaacatatcacacaagtgagcattgc tgccggagcttgcgtcgcttatttccaccacgggttgtcgccggtcctga agtcggtctccacccacggcacgaagacgaccttgccgtcgtcaacgtcc gcgtgaaccagggccagcgacagaggtgcaggcccacggacgaccttgcc ctggttgttgtactgggatccatggcaggggcagaggaacttgttctcgg cggcgttccacggcacgacgcatccaagatgcgtgcacacggcgttgatc ccgtaggtggcgagggtcttgtcggactcaaccacaaggtaggtaggatc acccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttga gccagtcctcgacgaggatgtcgttgccgagcttgtccttggcggcgacg cctccggcgttgctcccggagccggccgggacnaggaagganccgtangg gacnancatgccnaangtggggagcganatggcncccancangancangt tcatcanctccctcttgctcatgtccngnacncnnnccncnnanatnctg ccnnncatgcnnnnnatnttnntc
Download
page-top