Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604358
Length 684 bp
Fasta Format > rwhv3n1a16
ctgtatgaacatcacgcatgcagcaagcagcagcacggcctgactcaggg tgcaaaagctaagctgaagataagcacacaaatgtacaggatgtacagga cacatgcacagattacacaacctgggaatcatccacaggctaattgtcaa ttattattacaaataacactggatggttcaataagttgcggccaactgga tatataggactccagcaaactaaaacaaatgtagacatttgcgacgatga gatcaggcatggttactcgctggcttgacaacggtgaccgggcaggcggc gttgttcacgacgtaatcgctgacgctgcccaagagcaccctcttgagct tgccaaggcccctgctcccaatgaccaggcagctgatgggcatgtcatgg atggcttggcacagcttctcgcggggatctccaaacaggactttggaaac cacagcaacctccttctgcttagctatggtgttgagcatgtcaagtgttt cagcatcaggcttcaccccatatttctttgcagttgaaggctgagagaac tccgagagggggatcaaaggggagccggaggcctcccagaggagggtctc gccctgctcgtantcggggtccttgaggacgtgcaggaggancangttgt cnccnncncnnannnngntgnncncnnnncnntg
Download
page-top