Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604357
Length 440 bp
Fasta Format > rwhv3n1a15
gacactcatttaggaacgtggacatgagcgagacgccggtgcttttcttc agggcgatgccagctatatagaagtctaaaacccacaagttcagcttcag ctcgtatgtatgtaagtcagctcatgaactagagatgatcatggttcatg gatggacagggaccccaggaaccaccaccagcgggccgttaatggtactg gttccggtaccggttcccaccaccggcaggtctggcaaccccgaacccga agaagccttggactcggcgacgccggcaccgcgtgtcgctcccagtgcgc cgtccttctggctcagctccctcccgtcacaggacgcgagcaccaccacc aacagcagcgcgacggcgagacacttcgccattgctaantgggaggttct gaacttctgatactactgaggagacagtcttgctttagct
Download
page-top