Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604354
Length 856 bp
Fasta Format > rwhv3n1a10
ggaaaatgtgtcacacaaaatacacaatggcatctcaatctaatcctgat caacacctcatccacaaaatgttctactcttggcttattctcggtgtacc aaaaaatccctagcagttgctcgatgaagggcaagatttttcccacggcg cagttaactactcatacaagccagccacacttaagtcggacaccggcttt gacgaacagacgcaaggcaaggcggaaagagcagctttgaggataacaca acagcatctcatccaacgatgtaatcctactccccggccttctcctcctt ggcaatgtggaagccttcgatcttacacgcaatctcctctgctccagcct tgggtttaccatttgtatcgaccgcctcctcagcatccacgttaggtggg ctcagctgccagatccgaatagtaccatcttccgaccctgaggcgtatga ttcgccaccaggtgcaaaccggacgcagtgaactggaccatgatgccctt tgttacaggttatttcttcaccggtgaggaaatcaaatacatgaacccac atatcttctcctccagcaatgaatttgctcccggacttcggttcaagtga agctgactccacaataaacgacatatcatagcttttaacaagcccaaagt gattagcatcccaaaattttacacttgagccatcagctgtggtgatgaac ctgccatcctggcttacttctgcactggtaacaggtcccttggtttcaag agtttggacaattttttcactcctcacatcccataaccttactccacccg tatcagtgcaggaactcagtatagtttggtcattatgaaagccaagcaac agttcg
Download
page-top