Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ604350
Length 325 bp
Fasta Format > rwhv3n1a02
tgaccttgnangcntttttggggctgactccaccatcaacctcaatccag gggttcactcccttctcttcacataattttctcaaatcancaattttctt tacttggctctcaatgaagctttgcccaccaaacccagggttgactgaca taatcaataccanatcancagattcaagtacatattctatcgcactgagt ggggtcccanggttcaaaacaactccancctttgctcctanacttttaat ctgatcnactgttcggngcanatggatggttgccgnttgctcncnnngna cnctannnntatcnncacctgcctt
Download
page-top