Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709491
Length 791 bp
Fasta Format > whv3n19g16
ggtcattggccacgtcgactctggcaagtcgacgaccactggccacctga tctacaagcttggaggcattgacaagcgtgtgatcgagaggttcgagaag gaagccgctgaaatgaacaagaggtctttcaagtacgcctgggtgcttga caagctcaaggccgagcgtgagagaggtatcaccatcgatattgccctct ggaagtttgagacaaccaagtactactgcaccgtcattgatgcccctggt caccgtgacttcatcaagaacatgatcaccggtacctcccaggctgactg tgctgttctcatcatcgactccaccactggtggttttgaggctggtatct ccaaggatggccagacacgtgagcacgccctccttgctttcactcttgga gtgaagcagatgatctgctgctgcaacaagatggacgccaccactcccaa gtactcgaaggctcgttacgaagaaattgttaaggaggtctcttcgtacc tgaagaaggtcggctacaaccctgacaaggttcccttcgtccccatctct gggttcgagggtgacaacatgattgagaggtccaccaaccttgactggta caagggcccaaccctgcttgaggcacttgaccagatcaacgagcccaaga ggccctcagacaagcccctccgtcttcccctacaggatgtttacaagatt ggtggcattggaactgtgcctgttggccgtgttgagactggtgtcatcaa gcctggtatggttgttacctttggtcccactggtctgacaa
Download
page-top