Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709022
Length 608 bp
Fasta Format > whv3n17e15
gagcagcccatggtcaccctggagatgtgcatgactgggctggacaagaa gaaggcctctgtcttcttcaagactcaagctgatagccacgtttcctgcg ccaaggagatgaccaagctctctggtatctccgacatcattcccgagatg gaggtctgtgacttcgacttcgagccctgcggctactccatgaacgccat caacggatctgccgtctccaccatccatgtgacccccgaggacggcttca gctatgcgagctacgaggtcatgggcatggacgcctccgccctggcctac ggcgacatcgtcaagagggtcctccggtgctttggcccttcagagttctc tgcggcggtcaccatctttggtggccgcggccacgccgccacctggggca agaagctcgacgccgaggcatacgactgcaacaacgttgtggagcaggag ctcccctgtggaggcgtcctcatctaccanagctttaccgtgaacgaana ggttgctgtctctgccgggtcncccangtccntcttccactgcttcnagg ncnanantgtgcacanccaccctctggncaaggaangnnanctcnccanc ctcctcnc
Download
page-top