Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ708780
Length 391 bp
Fasta Format > whv3n16e10
cgtcctcctccacgggcaacatcacgctcagcgtcaccaagagcaagccg gagaccggcgaggtgatcggcgtcttcgagagcgtgcagccgtcagacac cgacctcggcgccaaggcgcccaaggatgtcaagatccagggtgtgtggt acgcgcagctcgagtctaactagagcagagcagaagtgaagatactcatc ttgtgtgcatgcgtacgtgggttgatcggtggagaggaaacaatcgaggc aacaatgtgtgtttgtgtgtgtatctagtaatctaaacccagggtgtcgg tttatattttagcttctgttattgtttcttcctcgcctactcatgatatt gatcccccatgaatgttcacaaaattgtctgaaaaaaaaaa
Download
page-top