Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ708638
Length 711 bp
Fasta Format > whv3n15l16
acgccaaccatcagctttcaatctagctaccagttccagtttagcacaca gattttttcctcgggccaacctccagatccatcaacaatggcgaactctg tgtccggagtggcggtgaacgaggagtgcgtgaaggcgttccaggagctg cgggcggaccgcaagcaccggttcgtggtgtacaagatggacgacgacgc gcagcaggtggtggtggacaaggtgggcgcgctcgacgccaccttcgacg acctggcggcggccatgcccgccgacgactgccgctacgccgtctacgac ctggacttcgtgtccgaggactcggccggcgagaccccccgcagcaagat cttcttcatccactggtcgccggagtcggcggacgcgaggaacaagatgc tgtacgccagctccacggaggggctcaagaaggagctggacggcgtgcag atcgacgtgcaggccaccgacgccagcgagctcaccctcgacatcctcaa ggactacaccacctaagttaatcgatgaatcacgtacgcgcttggcatcg cgttcctgcttggagttggatcgtgtcttgtggatccaaataatgttttt ccatgtgcagcggggtgtgaataattgatgagtggttttcttttcgggat tgataattgcgtggtttttctcttcaagaatgataattgagtggttgatt taaaaaaaaaa
Download
page-top