Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ708632
Length 178 bp
Fasta Format > whv3n15k24
atggcggaaggatcaggtgcatgcangtgtggccaattgagggcatcaag aagttcgagaccctgtcttacctgccacccctatccacggaggccctcct gaaacaggtcgactacctgatccgctcaaagtgggtgccctgcctcgagt tcagcaaggttggcttcgtcttccgtga
Download
page-top