Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ708424
Length 753 bp
Fasta Format > whv3n14o10
aaagccacaagccaagaaccaatacttgatctgttgttttctttagctcc cggaagaccttttagctgcaccgatcgatctcgatcatggaggatgagag gagcacccagtcataccagggaggtgaggccgccgagcaggtggaggtga cagacaggggcctcctcggcaacctcctcggcaagaagaaggcggaggag gacaaggagaagcaggaggagctggtcaccggcatggagaaggtctccgt ggaagagcccgaggttaagaaggaggagcacgaggatggcgagaagaagg agaccctcttctccaagctgcaccgatccagctccagctccagctcgtct agtgacgaggaagaggaggaggtgatcgatgacaacggtgaggtgatcaa gaggaagaagaagaagggtctcaaggagaagctcaaggagaagctgcccg gccacaaggacaccgagggtgagcacgtgacgggcctacccgcaccggcg gcccccgcgtctgtgcagacccaccatgacaccgacgtcgtcgtcgaaaa gatcgacggtgacgtgaagacagaggcggcaccggcagtgcccgaggagg agaagaaaggcttcttggaaaagatcaaggagaagctgcccggcggccac aagaaaccggaggacgctgctccggtgcccgtcacgcacgctgctccagc accagtgcacgcgccggcgccagccgccgaggaggtgagcagccctgacg cga
Download
page-top