Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ708414
Length 537 bp
Fasta Format > whv3n14n23
agactggtctcctcagtagtatcagaagttcagaacctcccagttagcaa tggcgaagtgtctcgccgtcgcgctgctgttggtggtggtgctcgcgtcc tgtgacgggagggagctgagccagaaggacggcgcactgggagcgacacg cggtgccggcgtcgccgagtccaaggcttcttcgggttcggggttgccag acctgccggtggtgggaaccggtaccggaaccagtaccattaacggcccg ctggtggtggttcctggggtccctgtccatccatgaaccatgatcatctc tagttcatgagctgacttacatacatacgagctgaagctgaacttgtggg ttttagacttctatatagctggcatcgccctgaagaaaagcaccggcgtc tcgctcatgtccacgttcctaaatgagtgtctgtatctgtatttcctctc agttcatgtttgtatttttcgttccttggtgtgccacatgtacgtatcat caacgtaatactacataatactttgttaaaaaaaaaa
Download
page-top