Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707989
Length 705 bp
Fasta Format > whv3n13a03
ctgaggtcaagtccgttgagatgcaccatgagtctctcctggaggcgctt cctggtgacaacgttggcttcaacgtcaagaacgttgccgtgaaggatct gaagcgtgggtttgttgcatccaactccaaggatgaccctgccaaggagg cagccaacttcacctcccaggtcatcatcatgaaccaccctggtcagatt ggcaacggctacgccccagtgctggactgccacacctcacacattgctgt caagtttgctgagctggtgaccaagatcgacaggcggtctggtaaggagc tggaggccctgcccaagttcctcaagaatggtgatgctggcatagtgaag atgattcccaccaagcccatggttgtggagacctttgccacttaccctcc tcttggtcgttttgctgtccgtgacatgaggcagactgtggctgttggtg tcatcaagggcgttgagaagaaggacccaaccggggccaaggtgaccaag gctgccatcaagaagaagtaattccacaattgatatccaaatcactgttt cagacaccaagcagtttttagtattggctgagttttgttaagggcattgt tcgtactgggtatattttagctgttcanctgttancgctgcatatcgtgc ccttggtggtgtctgtcttgtgccttacatactgtcctaatgtaagcttt ngtga
Download
page-top