Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707922
Length 378 bp
Fasta Format > whv3n12l24
gctgcaatatccaaaattccaaatcattcttctctcggcgacgcgattgg cagaggcggccatggagaaggggaaggccccagcggaggcagcggagtcg gcggcggcgtgtgcggcgcggctggcgcgtgagtggagcacttgggcgat gaagaacgcgaaggtggtcgcgcactacggcttcatccccctcgtcatcc tcgtcggcatgaggtccgagcccaagcccagcctcgcgcagctcctctcc cccgtgtagctattttccgcggcccgatccgcacggctgtgcgcgtattg aattgatcaacatttgtatttctccccaataatttcgattactctttgga ttgctctgatttggggtcaaaaaaaaaa
Download
page-top