Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707894
Length 644 bp
Fasta Format > whv3n12j24
atcgagctaggattgaacagaggaggggaggaagaagcttagggggtgcc ggccatggcgagcctgatggacaaggccaaggggttcgtcgccgacaaga tcgcgcacatgcccaagccggaggcgtcgctggacaaggtgaccttcaag ggcatgacccgcgaggccatcaccgtgcacagccacgtcaacgtcaccaa cccctactcccaccgcatccccatctgcgacatcgccttcaacctcaagt gcggcggcaaggaggtggcgagcggcacgatcccggacccgggctggatc gaggacagcggcgaggtcaccaagctggaggtgccggccaaggtgcccta cgacttcctcatctctctcatgaaggatctgggcagggactgggacatcg actacgaactcctcgtcaagctcaccatcgacctccccatcatcggcaac ttcaccatcccgctcgaaaccgccggcgagttcaagctgcccaccctcag cgacttcttcggcggcgccgccaagaccgaggaggccaccgcctagccat aagctcgatctagctcgcagcttgctctgcatccgcatgcctgtactcta ccgttgccgcaataatgagagcaaatattttcggaaaaaaaaaa
Download
page-top