Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707795
Length 762 bp
Fasta Format > whv3n12c23
cagagggtgtcaagcatggcgtccaagggtctacttgtgtttgctctcct gcttgctgctgctatcctcgtcgcctcaactgaacaaactcaggccaaga aggaggagaagaaagccgccgccgcctgtcctcgccgaggagaaggcgtc aggtcgatctccgcgaggacttcctctctctttctcccttgcatctggac cagcagcttgaactggagtgagctgatggaagctgaaagaagccagctta gtccaatcgacccaagaagagctcggtttccttgttgcatagtgtggact cccatacccttcatcacatggctgatgccatttatcggtcacattggcat ttgcagagaagatggtgtaatcttggactttgccggtccaaatttcgtgt cagttgacaactttgcctttggagctgttacacgctacatccaattaaat ggtgatgagtgctataaacttcttgacaccggcgcagagacgacatggga tggtgctctgaggaaaggcgtgcaggagtttcagaacaggaactacaacc tgttcacctgcaactgccactccttcgtcgccaacaacctgaaccggctc ttctacgccggccacgacaagtggaacgtggtgagcctggccgcggtgat gttccttcggggccgctgggtgagcgcgggagccgtggtgaagaccctgg cgccgttcgttgtggtgctcgcccttggcgttctcctcgggcggcacgac gttcttgctcgg
Download
page-top