Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707735
Length 276 bp
Fasta Format > whv3n11n14
gcgcgctcgacgacgtgctcagcctcggcaacaaggtgactgtggacaag gtcatggaggccatcgaggggcacgtgctgggggaggccgagatcacggc cgtgttctaaggagttcttgtggattttgacactcggctctgtgtgtgtg tgtgacctgcttgttacttcttgcgaattgtgtgtggtctgttctgtagc gtgcctgtatacgcatggccacgagcagcctttgtaattttgatccaata aatgaagtgacttcttaaaaaaaaaa
Download
page-top