Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707704
Length 712 bp
Fasta Format > whv3n11l10
agcagagcagataagataaggttcctgttcctcgaaggacaggcgcccga agaagacgacgccattgatggggatgggattcctacagcagctaatcagc cgatccccactgattgaagcggtggacgacactgaatgcatgcgagatcc gctgcggcgaatggctgccttgacggttgttggtgtggattaggtgccgg cgccggccgcgagtgcagacgcacagatctgctcgagcgtggtgtggttg gcagaaggaagaactcgtcgccgccctcgcaggtctccacgggaaggcca gcccacaagctcctcggtggttaaagagaacggctgcttcttcagtgccc aagcttgaaagatgttcatgtctatcgatgttgtgatatgttgatcggag caatcagaaacgaggtgagccgtggatcaggttctcgatttctgtctggt ctgtggctcagaaaagtcgatgctccatggattcaatgcaaggtgagtct gttctaccccaacgcggccgtcattttggaacttcanaagcaagggaggg agtggacgaacacacgaccgaaagcgatggatttcctcctgcaatcanga gatccactctgattgaggttggggagagtctagtgctggaaggtcgccgg cacatggcaccangcggacagtggtcaaggtgatgctgcangaggccatg ggtgtgagcgcc
Download
page-top