Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707454
Length 818 bp
Fasta Format > whv3n10l06
tgcggcacgaggccgaccgccgccgccgcctcctcgtcctctcggtcccc tctccttccttcgagtttgcttcagccatgggtaaggagaagactcacat caacatcgtggtcattggccacgtcgactctggcaagtcgacgaccactg gccacctgatctacaagcttggaggcattgacaagcgtgtgatcgagagg ttcgagaaggaagccgctgaaatgaacaagaggtctttcaagtacgcctg ggtgcttgacaagctcaaggccgagcgtgagagaggtatcaccatcgata ttgccctctggaagtttgagacaaccaagtactactgcaccgtcattgat gcccctggtcaccgtgacttcatcaagaacatgatcaccggtacctccca ggctgactgtgctgttctcatcatcgactccaccactggtggttttgagg ctggtatctccaaggatggccagacacgtgagcacgccctccttgctttc actcttggagtgaagcagatgatctgctgctgcaacaagatggacgccac cactcccaagtactcgaaggctcgttacgaagaaattgttaaggaggtct cttcgtacctgaagaaggtcggctacaaccctgacaaggttcccttcgtc cccatctctgggttcgagggtgacaacatgattgagaggtccaccaacct tgactggtacaagggcccaaccctgcttgaggcacttgaccagatcaacg agcccaagaggccctcagacaagcccctccgtcttcccctacaggatgtt tacaagattggtggcatt
Download
page-top