Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707404
Length 392 bp
Fasta Format > whv3n10h21
cggcgtcagcatcccctactccatcagcgcatccgtggactgctctaaga tccactgatcgattacttgccgccatcatcgccgattatagctccagcga tagatgccgagtacgttgaggtcacacacacacatatatatatatatata tacacatatacatgaataaatgctctgatatgatctccatgtgagagaca ggagtacgtacgtcgagccagctctgcatagccggccactgttgtatcta ttttgtatcagcgtttgattgttcgttcactccctttgagcagagacggg agtttgttgtactttgtaccatgtgcactcatggtattataaattaatct agctctattcagttaacacgcgtcgttatttgaaaaaaaaaa
Download
page-top