Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ707366
Length 490 bp
Fasta Format > whv3n10f09
caatggcgaagtgtctcgccgtcgcgctgctgttggtggtggtgctcgcg tcctgtgacgggagggagctgagccagaaggacggcgcactgggagcgac acgcggtgccggcgtcgccgagtccaaggcttcttcgggttcggggttgc cagacctgccggtggtgggaaccggtaccggaaccagtaccattaacggc ccgctggtggtggttcctggggtccctgtccatccatgaaccatgatcat ctctagttcatgagctgacttacatacatacgagctgaagctgaacttgt gggttttagacttctatatagctggcatcgccctgaagaaaagcaccggc gtctcgctcatgtccacgttcctaaatgagtgtctgtatctgtatttcct ctcagttcatgtttgtatttttcgttccttggtgtgccacatgtacgtat catcaacgtaatactacataatactttgttaaaaaaaaaa
Download
page-top