Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711434
Length 735 bp
Fasta Format > whv3n8i22
ctttgttgcttcaggttgcaacacctaaattaggctacaatggctctgag gctgtgggcgagctcagctgccaatgccctcaagatttcaagcagcggcg ccagggctgctgccccggcctattcgatctccagatacttctccactgtt attgatggcttgaagtacacttcctcccacgagtgggtcaagaacgacgg ctccgtggccacgattggcatcagtgaccacgcccagggccatctcgggg aggtggtgttcgtggagctgccggaggccggcacgaaggtgagccagggc ggagccttcggcaacgtggagagtgtgaaggccaccagcgacgtcaactc gcccatctccggcgaggtcgtcgaggtcaactcaaagctgtccgagaccc ccggccttatcaactcgagcccgtacgaggaggggtggatgatcaaggtg aagccgagcagcccggcggagctggagggcctgctggactcggccaagta caccaagcactgcgaggaggaggacgcccactagtgctccttgctcgatt atcgttccttttttgttgcaaccatgtcgactactcttgtctacaataat taaaccagcttcaccatgcgttcagttcatcggttccagttttcttttgt cnttgtacatggcgtccancagtttgttataccatttcantgaccgtgac atcanatatatggggaanagtttgtatgttanttt
Download
page-top