Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ711162
Length 572 bp
Fasta Format > whv3n7g02
gactgtctcctcagtagtatcagaagttcagaacctcccagttagcaatg gcgaagtgtctcgccgtcgcgctgctgttggtggtggtgctcgcgtcctg tgacgggagggagctgagccagaaggacggcgcactgggagcgacacgcg gtgccggcgtcgccgagtccaaggcttcttcgggttcggggttgccagac ctgccggtggtgggaaccggtaccggaaccagtaccattaacggcccgct ggtggtggttcctggggtccctgtccatccatgaaccatgatcatctcta gttcatgagctgacttacatacatacgagctgaagctgaacttgtgggtt ttagacttctatatagctggcatcgccctgaagaaaagcaccggcgtctc gctcatgtccacgttcctaaatgagtgtctgtatctgtatttcctctcag ttcatgtttgtatttttcgttccttggtgtgccacatgtacgtatcatca acgtaatactacataatactttgttaaaaaaaaaaacaaaactcccaaaa aggacggacatggcggcnanga
Download
page-top