Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ710504
Length 804 bp
Fasta Format > whv3n4f03
gcagcaaagagaatctaggaaaatgtgagcagttcttcttggaaatgatg aaagtgccaagggtggagtcaaaactgagaatcttatcctttaagataaa gtttcttacacaggttgcagacgtgaaaaataacctgaataccattaatg atgttgctgaagaggttaggaactctgacaagcttaagcgagtgatgcaa acaattctttccttggggaatgcattaaaccaaggaactgcaaggggttc agccgttggatttagattagatagtcttcttaagctcattgatatacggg cacgaaacaataagatgactctcatgcattatttgtgcaaggttcttgca ggcaagcttcctgaagttcttgattttgttaaggatcttgcgcatttaga acccgccacaaagatccaattgaaagacttggcggaggaaatgcaagcga taactaagggactggaaaaggtcgagcaggaactggcaacatctgaaaaa gatggtccagtgtctgagacgttttacaagaaactgaaggaatttctggc tgatgcccaagctgaagggaggtcattagcttcgctttacagtacagcgg ggaaaagcgcggactctctagcacattattttggtgaagatcctgtgcgg tgcccgtttgagcaagttgtctctactctgctaagcttcgtgaaaacctt cgagcgggcccatgccgagaacctcangcaggcggaggcggagaagaaga aagcccagatggaagctgaacgagagaaggcgaaggcagccgccgctcac aana
Download
page-top