Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ223353
Length 612 bp
Fasta Format > whdl4f12
gcgacgctcaagcccccagacgccgcagcgccgccactccacccgcagcg gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaaggg tagcaaaaagaaggccgtcgatccgttcaccaagaagcagtggtatgaca tcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg tccaggacacagggtaccaagattgcctcagagggtctgaagcacagggt gttcgaagtatctctagctgatcttcagaacgatgaggaccaggcctaca ggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcaca aacttctggggcatggacttcaccactgacaagctcaggtctcttgtgag gaagtggcagacactcattgaggctcatgtggatgtgaagaccactgaca actacatgctccgcatgttcaccattggcttcacgaagagacgcccaaac caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccg ccgcaagatggttgagatcatggtcaaccaagctgcaagctgtgacttga aggagcttgtga
Download
page-top