Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ710279
Length 775 bp
Fasta Format > whv3n3e03
ctgttcttctacagggacccagaggaagctaaggagcttgaggaagatga agctttgggtgctcctgagtacgctgcagttgcagagtacactgccccag caggggatacctggggtgctgaatggccaggagctgcagctccagctgct gccgccgaagccccggctggggccgagtggactggtgctccaggtttgaa tgaagattcttattttgtaattgcataattagattggaactttatgaaca acctctagtctcagtttcagcccacatttgagatcaacctgccgtcctag tttattctagtataattttatctctatatggtctttcctttatctgggga tagtaagttttcaagtttgttcacattgaattcataccccatttcttatc ctacccttttaccagatgccatttgctattctgtcctttctttttctgtc tctgcctatcagtttgactatttttttagcctgaaatgttcaaattgtac tcaaattacatttctgaatttcagctcctgctgccgatggatgggatgca gttccagcacctgcccctactggctgggaacagggcagcgctcccgcacc cgcagcagcaccagctgctactccgaactgggagtgaaggacttgaccca aggtttatgctactcggcactgtggagtgaaggagttcggccgcggttta tgggtgaaggctgtgttatttgcccccgtcantactttgttgggtanacn ctggntaagtanatttaatttttac
Download
page-top