Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ710243
Length 761 bp
Fasta Format > whv3n3b02
tatatatgggcatacgntatggtaacccattttttgtgttgctattttca accctgcctatgccagtgccaatttctgttgtttgtccaatcagatgctc atgcctatgtatctcgaaaatgagtacgcgtgatttcatttgctggcctc atatagttggaactggtaactagccatgttagtaacttgtgctgcagatt ttgtctatgtatcatctgagtttaccgccctaggtaccctttattatatt tccggactagttcatattatgtgtatatgggttgctttaaacatagagcc tcctttttttgattcctcaggaacttcactagttacaactgtattacgtt caataggaagtgattatggaaggccagggacctggtgttggatccagcag ggaagcacgggaaagattttacacttgattaccttttaccttccactttg gggtgccattctctacaatgggtttacgtactatcaagtaaaccgcatgt tgaacaatgcgacacggatggctgttggcatgagtgatcgatcaagtcaa tctgacgtgagggcagacaagaaggcatttaaccggtggggttattaccc tctgattttaattggttcatgggctttcgcaacaatcaatcgcctgtatg actttgctaatcctggtcacaagatattttggctatccatccttgatatt gggtttgctggacttatgggcctttttaattcgattgcttatgggtctca actcttcantg
Download
page-top