Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ710039
Length 657 bp
Fasta Format > whv3n2b21
tgccgaattcggcacgaggagaagcaggggatcatcagctcctccgccgc ggagacagggtacctgcaggacctggtgtacaagctgagcaaggtggggc aggccattgacaaggacgacctcgccgccgccggcgacgtcctcggcccc gcccccgacgcgccgtgggtgcagaacgtcaatgcagctttctccaagtt cagctcgagcagtgaggagaagagcgcggtcgacagcttcaactcctcgc tgtcctccttattcacatcagtgagcaagagcgacatcaactcgtccaag tcggcgttcgtgtcgtcggcgacggcgctggagaaatgggtggagctggc cgggctcaccggcaagctcaagggcttctgaattttctgagatgagtgaa ttgttgctgtctgacgagtacatacctacctacctggagatgatgttttc cttcaagcgctggcttgatgatgttctccatgcaactgatacatgtgttg attctatcgtaaccacggtttcnacgggaaaacaatctgttanagtcaca attccctctgtttttcttccccttgttganatgtaaaagacattttttgt gtcaagaaattatttgcagtgtattangatcttgangaanaaaaagtaag ttcatca
Download
page-top