Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709722
Length 142 bp
Fasta Format > whv3n1k04
gctcccacctagcaattcacgtactccgccatggccccagaccgtgatgg cttcctccgccaccaccgatcgcgcccttccaggggctcaagtcgaccgc cggcctccccgatcagccgccgcntccggcagcgccggnctc
Download
page-top