Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709668
Length 255 bp
Fasta Format > whv3n1f06
gccgctctaaactagtgagccgtgagcccgtgacaagtttgtttctctcc cgtagtcccacactcgaacgagatggctgacgagtacggccgcggcggct acggcaggtccgctgccggcgacgactacgacaacaagaccagcaacgag ggctacgaccgccgagaaggtggctacaacaagtccggcgccgacgacta cgagcacgagcgcagcagcggccgcggtggctacaacaagtccaccggcg acgac
Download
page-top