Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709662
Length 500 bp
Fasta Format > whv3n1e20
cctgggaatctaatgagctgcctagtggcccttccttcccccagctacat gctgttagggtttcggcgtccagagtgggggcatgcccaagctgttcttc ccctcctctgctctgagttgtgacttatgacacatcaaatcaaactgaga gatgagatggagggaagaacatgcatatgctggtagatagtgacaggtgg ggttcccctcaacaaggggggagggagtgtgtttgaaagagttgaaaggg agatttgaagaaaggaggagaacgaggagctctgtgtaaagcttggaaaa ggattggcagggttggcttttagcgtgcacaagtttacttgcgatgactc gcctctgtctctgtgtgttgcttttgctttattgaaagatgggatttgtt ttctcttttggcagaanaacatattccangattaaaggtggtggtgctgt tgacnaactgacacattangaggaccatgngntttctcaacaggtgtaat
Download
page-top