Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709635
Length 680 bp
Fasta Format > whv3n1c11
aacgcaaactccgttcgttccccaccaccatctcgtcgaaaacctagaaa ttcggagtgagattgtgttcgtccgttcgctttcgtttcttcgagatctg tgaggaggggggagagacagatccgtcgcttgctccctgttcgaggtttg tgacgaggacgagcagcagattcgacgcgcgcctccgaggttcttcctgg aactaatttgatgtgctatggaatccaagggtggtaaaaagtccagcagt agtcgttcctccctcatgtacgaagctcccctcggctacagcatcgagga cgtccgccctgcaggaggcattgagaagttccgctccgctgcctactcaa actgctccaggaagccatcctgataatccctctcgcgcccccatcctaat tgcttagaattcccttctgctttcaattcatcttcctaaaatttctctgg ctagctgcttttctctgaccagcaaagcctttcctcctctaccaaccttc tcaaacaatggccgtctctgcgattgggtttgagggatatgagaagcgcc tggagatcaccttctctgaagcgccagtcttcactgaccccaatggcagg ggattgcgtgctctctctcgtgcccagatcgactcggttcttgatcttgc caagngcaccattgtatctgagctctctaa
Download
page-top