Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709634
Length 625 bp
Fasta Format > whv3n1c10
atgcaactgaaataagagcggatgcattgaagttgttagtcatgttgaaa agacctgttccccgtgctgcagctacagttggtgcagattgccggaaatc gggcaggctctcctgccttcatctggtgaagctaanagccaaccagcagc agcaacagcggcagcgccccctgctgccacggcaactgctgcaccagtag cagaaccagcagccccagctgctgccacggcaactgctgccccagtagca gaaccagcagccccagctgctgccacggcaactgctgcaccagtagcaga accagaagccccagctgcagaagccagcacagagtcgcctcctgatacca caacatcatcgagacccctgtcaccatttgcaaattacccagatctcaaa ccaccggccagcccttccccaccagcttcagagggtaaaaccgaggtgaa ggccaccgttgtcgcagcaaccgaatcgccggcggaagttaactcggcac cggtggcagaagctgtcgaagagtcatcgcctcctgcgaagcccaggcct ctttcgccatatgcgaactatccagatctcaaaccgccggcctctccttc gccttcgccgccttagtgatgggtt
Download
page-top