Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709633
Length 554 bp
Fasta Format > whv3n1c08
catcgtggtgattggccacagccgctgcggtggaatcaaggctctgctct cactcaaggatggcgcagacgactccttccacttcgtcgaggactgggtc aggatcggcttcccggccaagaagaaggtgcagactgagtgcgcctccat gcctttcgatgaccagtgcaccgtcctcgaaaaggaggcagtgaacgtgt ccctgcagaacctcctgacctacccgttcgtcaaggagggtgtgtccaac ggaaccctcaagctcgtcggcggccattacgacttcgtctccggcaagtt cgagacatgggagcagtaaatcttccccagcggttaactcctatatatac atgcgaatgcaaacgcgtacatatatcaagatatcgtccgaccgaccgat gtgaatccaatgccatggagtgcgtactcgttgttttccagtactggatg ccgggatggcccgatgtgaattcgccataagcaatagaaccctttttctt ttaccnttttctgacnaggaattgtactaccatgtgatncataatttgat cgtc
Download
page-top