Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709629
Length 317 bp
Fasta Format > whv3n1b24
tccaatccaaggcggaggtcgagatcaaacctaccggagatgaagttctt ctcggcgttcgacccgtggccggtgttcttccgccgggagtggggccgca cctggcccttcctcgccggcttcgccgtcacgggggccctcatcaccaag atgaccgccggcttcaccgaggaggacctcaagaactccaagttcatcca ggcgcacaagaagaagtagtcgccgcccgcccggcccgtccgccgccagg tcacaggggcagcanctgagtaaccagcatgtgtccttgatgcggggagc cagtcctcaccctcact
Download
page-top