Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ709607
Length 561 bp
Fasta Format > whv3n1a04
ctggtgctacgcaaccgtagtcgcgccccgtgcccgctcctccaccatcg tcgccagcctcggcacccccgcgccctccaactcctcctccttccgcccc aagctcatcaggaacacccccgtccaggccgcccccgtcgcacccgcatt gatggacgccgccgtggagcgcctcaagaccgggttcgagaagttcaaga ccgaggtctacgacaagaagcccgatttcttcgagcccctcaaggccggc caggcgcccaagtacatggtgttcgcgtgcgccgactcccgtgtgtgccc ctcggtcaccctgggcctggagcccggcgaggccttcaccatccgcaaca tcgccaacatggtcccctcctactgcaagaacaagtacgccggtgttgga tcggccatcgaatacgccgtctgtgctctcaaggttgaggtcatcgtggt gattggccacagccgctgcggtggaatcaaggctctgctctcactcaagg atggcgcanacgactccttnnacttcgtcgaggantgggtcaggatcngn ttcccggncaa
Download
page-top