Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ598582
Length 847 bp
Fasta Format > rwhv16n17a23
gtaacacgtaacaaaataagataactgaacgctggctaggaatgtcgaca gaagtactcaagaaatcagccatcaaaactgactacaaagttcacgacac ccaggtggcacatatatcatcttctagatatgaagcagcaaaatagcgac ttctattttctactcagcagcagcaacctcctccgctccaggaatcacct catctccatcagcaggcctgtcaagcttcacaccaacatcctccttgtag tcaccgtgcacctccatgagcttccccaggtcaaacttgggggccttcag gatcttcaccttgcggacgtacacgttctggagggggaagatgcttgagg tggccttctcaatctcctttccaatcanctcagggatgaacttgttcaca agctccttcaagtcacngcttgcagcttggttgaccatgatctcaaccat cttgcggcggatctgtctgatctgacttgcttgggcatagcaagtgcgct tcacctggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagc atgtagttgtcagtggtcttcacatccacatgagcctcaatgagtgtctg ccacttcctcacaagagacctgagcttgtcagtggtgaagtccatgcccc anaagtttgtgaggacattaatcccttgcacatcctcancacggagtctg atcttcctgtaggcctggtcctcatcgttctgaanatcanctanagatac ttcnaacaccctgtgcttcnaccctctgaggcaatcttggtaccctgtgt cctggacacnanggtcttgccnannntgnngntggngaacnnnnnng
Download
page-top