Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ598425
Length 825 bp
Fasta Format > rwhv16n16h16
acgcagaatcataacagaaaatgcagttccattgctcccatgatttctgt tcaagataagactagtacgattaaatacttgttgatattcgcttaggcaa acacaaaattggtatcagtgaaacagatctaatccaaagacaagcagggg tcggcaggaaagcccggtatcttatcaacttcactggagcgcacacactt agaacacccgtacacgcttccccatggtgctcttcacgtacaggcacctc acattctgccaattcttcttcaggagggacacaaggaagttgacactcat ttggatgttttgttggatctgcttctcgtccatcgacaagttgcccacag caacacccatgcaaagaaccttctttagctggaacttgactgtagctttt gtctcgttgaccttggcttcaagagattcctggtgactaaccagagtggg aaacttgcctgccttgttaagaccagggccaaggagacgagggatctgct tgattatggcctctgatgccaagaaagcatggtacttcttggctagcttc ttaacaagcttcttgttcttgttcatcttcttgagactttcaacatccat gtagtcaagtcccattttctcagcctggtcgacatgctgggcatcaccaa gcatgcacaccctcatctttgggcgggggatatggggcagcttcactgag ccgctgaaacgtttgtccttttgtgggtcgtantttttganaccgatctg aanctcccagnctcantgaacttgcncttcttttctctcnccctccccan cnatctgggngatggcatccttaac
Download
page-top