Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ598318
Length 474 bp
Fasta Format > rwhv16n16a14
atcatacacactttgttttattccattacgcttgtagtcaactcgctaag taacatcgtgcaaaccgccatgactctctcaacaacaatatcttggagtt ttcaaaggtcacggcggcatcatctgtgcgtggtcatcaagcgacggtgt tggccggggtcacctccggtgcaggcgcggcgtctgctgccggggttgcc tcaggtgcaggcacggcgtcggctgccggggtagcctccggtacaggagt ggcttcggcctcccagaaggcggtcttcttcccggtcttggagaccgtct ggaaaacgtcttctggcttgacgttgcccttcacggtcaccttctgctgc tccatgtctatgtcaaagctctcgacgccttccattttggtgagcaccct tttaaccgcccccgagcaacctccgcagganattgccaccttgangacaa cagtctcngaggccatggctggca
Download
page-top